Metastasis-associated lung adenocarcinoma transcript 1 gene polymorphism in Egyptian patients with hepatocellular carcinoma

Nesreen G Elhelbawy; Manal A Safan; Mostafa G Elhelbawy; Basma A Mostafa; Noha R Bayomy

doi:10.4103/mmj.mmj_200_22

ORIGINAL ARTICLE

Year : 2022 | Volume : 35 | Issue : 4 | Page : 1625-1629

Metastasis-associated lung adenocarcinoma transcript 1 gene polymorphism in Egyptian patients with hepatocellular carcinoma

Nesreen G Elhelbawy¹, Manal A Safan¹, Mostafa G Elhelbawy², Basma A Mostafa¹, Noha R Bayomy¹
¹ Department of Medical Biochemistry and Molecular Biology, Faculty of Medicine, Menoufia University, Menoufia, Egypt
² Department of Hepatology, National Liver Institute, Menoufia University, Menoufia, Egypt

Date of Submission	12-Jun-2022
Date of Decision	07-Jul-2022
Date of Acceptance	17-Jul-2022
Date of Web Publication	04-Mar-2023

Correspondence Address:
Manal A Safan
Department of Medical Biochemistry and Molecular Biology, Faculty of Medicine, Menoufia University, Shebin Elkom
Egypt

Source of Support: None, Conflict of Interest: None

Check

DOI: 10.4103/mmj.mmj_200_22

Abstract

Objective
To evaluate the relation between rs619586 metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) gene single nucleotide polymorphism (SNP) and hepatocellular carcinoma (HCC) risk on top of hepatitis C virus (HCV).
Background
HCC is a type of primary liver cancer. It has a multitude of etiological risk factors such as HCV. The MALAT1 is a long noncoding RNA. It affects tumor cell proliferation and migration in many types of malignancy.
Patients and methods
The study included 80 subjects: 40 patients with HCC on top of HCV and 40 healthy controls. Genotyping of MALAT1 SNP (rs619586) was performed by real-time PCR.
Results
There were no significant statistical differences regarding the genotypes or allele distribution of MALAT1 SNP (rs619586) on comparing HCC on top of HCV with controls.
Conclusion
This study found that there was no significant statistical difference regarding the genotypes or allele distribution of MALAT1 SNP (rs619586) on comparing HCC on top of HCV with controls.

Keywords: hepatocellular carcinoma, metastasis-associated lung adenocarcinoma transcript 1, real-time PCR

How to cite this article:
Elhelbawy NG, Safan MA, Elhelbawy MG, Mostafa BA, Bayomy NR. Metastasis-associated lung adenocarcinoma transcript 1 gene polymorphism in Egyptian patients with hepatocellular carcinoma. Menoufia Med J 2022;35:1625-9

How to cite this URL:
Elhelbawy NG, Safan MA, Elhelbawy MG, Mostafa BA, Bayomy NR. Metastasis-associated lung adenocarcinoma transcript 1 gene polymorphism in Egyptian patients with hepatocellular carcinoma. Menoufia Med J [serial online] 2022 [cited 2023 Jun 9];35:1625-9. Available from: http://www.mmj.eg.net/text.asp?2022/35/4/1625/370973

Introduction

Hepatocellular carcinoma (HCC) is a primary hepatic cancer and a common cause of mortality in people with cirrhosis ^[1]. In developing countries, chronic infections with hepatitis C virus (HCV) is an important major cause of HCC ^[2]. Other factors of increasing incidence of HCC in Egypt are cigarette smoking, occupational exposure to chemicals, and endemic infection with schistosomiasis. These factors have great effects on disease progression. A golden opportunity for prevention can be realized by evaluating the great burden of cancer implicated by these factors ^[3]. Long noncoding RNAs (lncRNAs) are types of RNA molecule that are unable to encode proteins. Their length is more than 200 nucleotides ^[4]. lncRNAs regulate gene expression through chromatin modification, transcription, and posttranscription regulation ^[5]. lncRNAs may regulate the process of transcription through interacting with RNA-binding proteins, co-activating transcription factors, or repressing the promoters of target genes ^[6]. Although these lncRNAs are unable to code for proteins, their roles in cellular functions are indispensable and complex ^[7].

Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a long intergenic noncoding RNA (lincRNA); its length is more than 8000 nucleotides, and it is located on chromosome 11q13 ^[8]. lncRNAs have potentially important biological functions indicated by having highly conserved sequences among species ^[9]. The MALAT1 gene was firstly noticed to be associated significantly with metastasis of early-stage nonsmall cell lung cancer (NSCLC), and this leads to consider MALAT1 as a prognostic marker for stage I NSCLC ^[8]. In addition, many non-cancer diseases, such as myocardial infarction and hyperglycemia, have also been documented to be associated with MALAT1 ^[10].

MALAT1 was identified to perform an important role in regulating the endothelial cell function and the growth of vessels ^[11], and this was evidenced in the circulatory system ^[12]. The aberrant expression of MALAT1 in patients with myocardial infarction indicated that it performs a role in cardiovascular diseases ^[13]. The expression of MALAT1 is regulated by various genes and proteins during transcription and posttranscriptional processing. Sp1 and Jumonji domain-containing protein 1A (JMJD1A) were reported to regulate the expression of MALAT1 via binding to the gene promoter, so affecting the process of transcription ^[14]. A great effect on tumor cell proliferation, invasion, and migration in HCC was observed by MALAT1 gene expression upregulation ^[15].

Single nucleotide polymorphisms (SNPs) can affect the expression of the coding genes and lncRNAs ^[16]. The purpose of this work was to assess the association between rs619586 MALAT1 gene SNP and HCC risk.

Patients and methods

This was a prospective cohort study conducted on 80 subjects, classified into two groups: group I included 40 patients with HCC on top of HCV and group II included age-matched and sex-matched apparently healthy persons as the control group. This study was carried out between December 2020 and March 2021 in the medical biochemistry and Molecular Biology Department of Faculty of Medicine and the Hepatology Department of National Liver Institute, Menoufia University. It included patients with HCC on top of HCV infection. Patients with history of liver transplantation, other malignant neoplasm, HIV, chronic lung diseases, and renal insufficiency were excluded from this work.

All our participants were subjected to the following: history taking, clinical examination, abdominal ultrasound, triphasic computed tomography (CT) scan or MRI for patients with HCC, liver function tests, HCV antibodies, and HbsAg.

A written informed consent was obtained from all participants, and this research was approved by the ethical committee of Medical Research, Faculty of medicine, Menoufia University (no: BIO-.191219).

Samples collection: overall, 6 ml of venous blood was taken by venipuncture under restrict sterile conditions: 1 ml was collected into EDTA-containing tube for DNA extraction and it was kept at −80°C until DNA extraction was done. Two milliliters of venous blood was collected into EDTA tubes for complete blood count. Two milliliters was collected into a plain tube and centrifuged, and serum was kept at −80°C until laboratory investigations. One milliliter was collected into sodium citrate-containing tubes for prothrombin time determination. Liver function tests were performed by colorimetric methods by kits supplied from Spinreact according to the manufacturer's manual using COBAS 6000 autoanalyzer (Roche Diagnostics International AG, Rotkreuz, Switzerland). HCV antibodies were assessed by the enzyme-linked immunosorbent assay technique using kits supplied by Siemens (Berlin, Germany) according to the manufacturer's manual using COBAS.

Molecular study: DNA was extracted from the whole blood into an EDTA tube by Thermo Scientific GeneJET Genomic DNA Purification Kit, Lithuania (Waltham, Massachusetts, United States).cat#K0721. The extraction was done according to the instruction of the kit. Assessment of the purity and quantity of extracted DNA was done by Nanodrop. The extracted DNA were kept at −80°C until genotyping.

Genotyping of MALAT1 (rs619586) SNP is done by real-time PCR (allelic discrimination assay). The reaction used TaqMan universal master mix II (2×), supplemented with analysis and TaqMan probes. The probe sequences were described by the manufacturer.

[VIC/FAM]:

CTTCAAAAGGTGGTAAACTATACCT[G/A] CTGTCCCTCAAGAGAACACAAGAAG.

Overall, 10 μl of the master mix was mixed with 1.5 μl of the primer/probe mixture and 3.5 μl of nuclease-free water. Five microliters of DNA extract was added to every reaction. The cycling conditions were done as follows: initial denaturation at 94°C for 4 min (one cycle) then denaturation at 94°C for 30 s, annealing at 50°C for 25 s, and extension at 72°C for 40 s (50 cycles). The final extension was performed at 72°C for 3 min (one cycle).

Data were analyzed using the software of the ABI 7500 real-time PCR instrument, V.2.0.1 (Applied Biosystems, Foster City, California, USA), which measures the fluorescence generated by PCR amplification. The plotted fluorescence signals indicate which alleles are present.

Statistical analysis

The data obtained were tabulated and analyzed using SPSS (statistical package for the social sciences software) statistical package, version 20 on IBM compatible computer (IBM Corp., Armonk, New York, USA). Qualitative data were described using number and percent. The Kolmogorov–Smirnov test was used to verify the normality of distribution. Quantitative data were described using range mean, SD, median, and interquartile range. Significance of the obtained results was judged at the 5% level.

Results

Regarding patients with HCC with HCV infection, 36 (90%) patients had cirrhosis, 22 (55%) patients had portal venous thrombosis, and 26 patients had portal hypertension. The presenting symptom was abdominal pain in 18 (45%) patients, chest pain and back pain each in three (7.5%) patients, and seven (17.5%) patients were presented with abdominal pain and dyspepsia [Table 1].

Table 1: Statistical analysis of clinical data and tumor characteristics of the patient group

Click here to view

The tumor size varied from less than 5 cm in 17 (42.5%) patients and more than 5 cm in 23 (57.5%) patients. A total of 11 (27.5%) patients had early-stage HCC and 19 (47.5%) patients had metastatic tumor [Table 1].

Regarding comparison between the patient group with the control group, there were significant statistical differences concerning platelet count, prothrombin time, total bilirubin, aspartate transaminase (AST), and alanine transaminase (ALT). However, there were no significant statistical differences regarding hemoglobin concentration [Table 2].

Table 2: Statistical comparison between the two studied groups according to laboratory parameters

Click here to view

There were no significant statistical differences regarding the genotypes or allele distribution of MALAT1 SNP (rs619586) on comparing group I (HCC/HCV) with group II (controls) (P = 0.734, P = 0.689, and P = 0.598, for AG, GG, and allele G, respectively) [Table 3].

Table 3: Statistical comparison between the two studied groups according to MALAT1 rs619586 gene polymorphism

Click here to view

Discussion

The major type of primary hepatic malignancy is HCC, accounting for 75 to 85% of cases ^[17]. Early-stage HCC can be treated effectively by liver transplantation or curative surgery. However, therapeutic strategies are still limited for advanced cases ^[18].

Upregulation of MALAT1 in tumor tissues or sera may be correlated with advanced tumor stages and reduced overall survival of patients with HCC ^[19].

MALAT1 expression was found to be upregulated in varies types of tumor, and MALAT1 exhibited novel effects on tumor cell proliferation, migration, invasion, and apoptosis ^[20].

In this current study, our goal was to assess the association between MALAT1 gene SNP (rs619586) and HCC risk.

In agreement with our results, the study by Yuan et al.^[21] detected no significant differences between patients with HCC and the healthy subjects regarding the distribution of age less than 55 and more than or equal to 55 years (P = 0.451) and sex (P = 0.797). Similarly, Motawi et al. ^[22] demonstrated that there was no statistically significant difference between patients and controls regarding age and sex.

On comparing group I and group II in our research, there was a significant decrease in platelet count, prothrombin time, and serum albumin. However, there was a significant increase in total bilirubin, AST, and ALT. There were no significant statistical differences regarding hemoglobin concentration.

In accordance with our results, the study by Li et al. ^[14] reported that there was a statistically significant difference between HCC cases and controls regarding AST, ALT, and bilirubin.

Moreover, Sheta et al.^[23] revealed that there was a significant increase in ALT and AST levels among HCC cases compared with cirrhotic cases.

Our results showed that there were no significant statistical differences regarding the genotypes or allele distribution of MALAT1 SNP (rs619586) on comparing group I (HCC on top of HCV) with group II (control).

Our results were supported by the study of Yuan and colleagues, as they examined the possible associations of MALAT1 SNPs with the risk of getting HCC. The genotype frequencies of three SNPs (rs3200401, rs619586, and rs1194338) were first assessed in the whole population they recruited. They found that alleles with the highest distribution frequencies for rs3200401, rs619586, and rs1194338 SNPs were homozygous C/C, A/A, and C/C, respectively. However, after adjusting for age, sex, cigarette smoking, and alcohol consumption, there were no significant differences between patients with HCC with these candidate SNPs (rs3200401 CT/TT, rs619586 AG/GG, and rs1194338 CA/AA) and those with the wild-type gene ^[21].

Liu et al. ^[24] found that rs619586 AG+GG genotypes were associated with a decreased risk of HCC, with borderline significance.

After identification of MALAT1 in NSCLC ^[25], a subsequent research on NSCLC about MALAT1 hypothesized that the aberrant overexpression of MALAT1 in stage I and II NSCLC primary tumors increased the risk of metastasis ^[26]. In addition of this finding, MALAT1 overexpression contributed to brain metastasis by promoting epithelial-mesenchymal transition in NSCLC ^[27]. The role of MALAT1 in digestive system cancer deserves wide attention. It was demonstrated that in ESCC, the overexpression of MALAT1 enhanced tumor proliferation and metastasis ^[28].

Conclusion

MALAT1 SNP (rs619586) could not be considered as a genetic risk factor of HCC.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

References

1.	Dimitroulis D, Damaskos C, Valsami S, Davakis S, Garmpis N, Spartalis E, et al. From diagnosis to treatment of hepatocellular carcinoma: an epidemic problem for both developed and developing world. World J Gastroenterol 2017; 23:5282.
2.	Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018; 68:394–424.
3.	Anwar WA, Khaled HM, Amra HA, El-Nezami H, Loffredo CA. Changing pattern of hepatocellular carcinoma (HCC) and its risk factors in Egypt: possibilities for prevention. Mutat Res Rev Mutat Res 2008; 659:176–184.
4.	Ponting CP, Oliver PL, Reik W. Evolution and functions of long noncoding RNAs. Cell 2009; 136:629641.
5.	Wilusz JE, Sunwoo H, Spector DL. Long noncoding RNAs: functional surprises from the RNA world. Genes Dev 2009; 23:1494–1504.
6.	Wang F, Ren S, Chen R, Lu J, Shi X, Zhu Y, et al. Development and prospective multicenter evaluation of the long noncoding RNA MALAT-1 as a diagnostic urinary biomarker for prostate cancer. Oncotarget 2014; 5:11091.
7.	Mercer TR, Dinger ME, Mattick JS. Long non-coding RNAs: insights into functions. Nat Rev Genet 2009; 10:155–159.
8.	Djebali S, Davis CA, Merkel A, Dobin A, Lassmann T, Mortazavi A, et al. Landscape of transcription in human cells. Nature 2012; 489:101–108.
9.	Wang X, Arai S, Song X, Reichart D, Du K, Pascual G, el al. Induced ncRNAs allosterically modify RNA-binding proteins in cis to inhibit transcription. Nature 2008; 454:126–130.
10.	Michalik KM, You X, Manavski Y, Doddaballapur A, Zörnig M, Braun T, et al. Long noncoding RNA MALAT1 regulates endothelial cell function and vessel growth. Circ Res 2014; 114:1389–1397.
11.	Liu JY, Yao J, Li XM, Song YC, Wang XQ, Li YJ, et al. Pathogenic role of lncRNA-MALAT1 in endothelial cell dysfunction in diabetes mellitus. Cell Death Dis 2014; 5:e1506.
12.	Uchida S, Dimmeler S. Long noncoding RNAs in cardiovascular diseases. Circ Res 2015; 116:737–750.
13.	Vausort M, Wagner DR, Devaux Y. Long noncoding RNAs in patients with acute myocardial infarction. Circ Res 2014; 115:668–677.
14.	Li C, Peng Y, Mao B, Qian K. Thioredoxin reductase: a novel, independent prognostic marker in patients with hepatocellular carcinoma. Oncotarget 2015; 6:17792.
15.	Hu Z, Chen J, Tian T, Zhou X, Gu H, Xu L, et al. Genetic variants of miRNA sequences and non–small cell lung cancer survival. J Clin Investig 2008; 118:2600–2608.
16.	Arun G, Diermeier SD, Spector DL. Therapeutic targeting of long non-coding RNAs in cancer. Trends Mol Med 2018; 24:257–277.
17.	Amodio N, Raimondi L, Juli G, Stamato MA, Caracciolo D, Tagliaferri P, et al. MALAT1: a druggable long non-coding RNA for targeted anti-cancer approaches. J Hematol Oncol 2018; 11:1–9.
18.	Chen LL. Linking long noncoding RNA localization and function. Trends Biochem Sci 2016; 41:761–72.
19.	Liu J, Dong H, Yang Y, Qian Y, Liu J, Li Z, et al. Upregulation of long noncoding RNA MALAT1 in papillary thyroid cancer and its diagnostic value. Future Oncol 2018; 14:3015–3022.
20.	Hou Z. The long non-coding RNA MALAT1 promotes the migration and invasion of hepatocellular carcinoma by sponging miR-204 and releasing SIRT1. Tumour Biol 2017; 39:7.
21.	Yuan LT, Chang JH, Lee HL, Yang YC, Su SC, Lin CL, et al. Genetic variants of lncRNA MALAT1 exert diverse impacts on the risk and clinicopathologic characteristics of patients with hepatocellular carcinoma. J Clin Med 2019; 8:1406.
22.	Motawi TM, El-Maraghy SA, Sabry D, Mehana NA. The expression of long non coding RNA genes is associated with expression with polymorphisms of HULC rs7763881 and MALAT1 rs619586 in hepatocellular carcinoma and HBV Egyptian patients. J Cell Biochem 2019; 120:14645–14656.
23.	Sheta T, Selim M, Sabry M, Saed A. Serum thioredoxin as a diagnostic marker for hepatocellular carcinoma in cirrhotic hepatitis C patients. Med J Viral Hepat 2021; 5:9–15.
24.	Liu Y, Pan S, Liu L, Zhai X, Liu J, Wen J, et al. A genetic variant in long non-coding RNA HULC contributes to risk of HBV-related hepatocellular carcinoma in a Chinese population. PLoS One 2012; 7:e35145.
25.	Gutschner T, Hämmerle M, Eißmann M, Hsu J, Kim Y, Hung G, et al. The noncoding RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells. Cancer Res 2013; 73:1180–1189.
26.	Müller-Tidow C, Diederichs S, Thomas M, Serve H. Genome-wide screening for prognosis-predicting genes in early-stage non-small-cell lung cancer. Lung Cancer 2004; 45:S145–S150.
27.	Shen L, Chen L, Wang Y, Jiang X, Xia H, Zhuang Z. Long noncoding RNA MALAT1 promotes brain metastasis by inducing epithelial-mesenchymal transition in lung cancer. J Neuro-Oncol 2015; 121:101–108.
28.	Hu L, Wu Y, Tan D, Meng H, Wang K, Bai Y, et al. Up-regulation of long noncoding RNA MALAT1 contributes to proliferation and metastasis in esophageal squamous cell carcinoma. J Exp Clin Cancer Res 2015; 34:1–3.