Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2021  |  Volume : 34  |  Issue : 1  |  Page : 231-236

Glutathione S-transferase (GSTM1 and GSTT1) polymorphisms' relationship between glycemic control of diabetic mothers and their infants


1 Department of Pediatrics, Faculty of Medicine, Menoufia University, Menoufia, Egypt
2 Department of Obstetrics and Gynecology, Faculty of Medicine, Menoufia University, Menoufia, Egypt
3 Department of Pediatrics, Ministry of Health, Menoufia, Egypt

Date of Submission18-Aug-2019
Date of Decision01-Sep-2019
Date of Acceptance06-Sep-2019
Date of Web Publication27-Mar-2021

Correspondence Address:
Shimaa F.N. Dawoud
El Omara Street, Sirs Elyian City, El-Menoufia Governorate
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/mmj.mmj_258_19

Rights and Permissions
  Abstract 


Objective
To evaluate the glutathione S-transferase genetic variants (GSTM1 and GSTT1) in pregnant mothers with gestational diabetes mellitus (GDM) and the degree of glycemic control.
Background
Previous research has declared that GDM affects both the mother and the baby during pregnancy and in the long term.
Patients and methods
To reach the goal of this research, a case–control study was designed. A total of 80 pregnant women were divided into two groups: (a) patients group (40 patients had GDM during the third trimester of pregnancy) and (b) control group (40 apparently healthy pregnant women). All participants were subjected to detailed history taking, complete general examination of all body systems, laboratory investigations, and molecular genetic study.
Results
We found that there was a statistically significant difference in GSTT1-0 null genotype rates between mothers with GDM and controls (P = 0.04). However, there was no difference in the frequencies of GSTM1 null genotypes between mothers with GDM and controls (P = 0.112). GSTM1 was more prevalent in infants of diabetic mothers (IDM), with a significantly difference between IDM and controls regarding GSTM1 null genotypes (P = 0.04). This difference was positively associated with higher levels of respiratory rates above normal limits and low 1 min APGAR score.
Conclusion
Our study reveals that GSTM1-0 null genotype in IDM was positively correlated with the unfavorable presentation among affected newborns who are carriers of this polymorphism.

Keywords: diabetic, glutathione, mothers, neonates, pregnancy


How to cite this article:
Abou El-Ella SS, Barseem NF, Dawood RM, Dawoud SF. Glutathione S-transferase (GSTM1 and GSTT1) polymorphisms' relationship between glycemic control of diabetic mothers and their infants. Menoufia Med J 2021;34:231-6

How to cite this URL:
Abou El-Ella SS, Barseem NF, Dawood RM, Dawoud SF. Glutathione S-transferase (GSTM1 and GSTT1) polymorphisms' relationship between glycemic control of diabetic mothers and their infants. Menoufia Med J [serial online] 2021 [cited 2021 May 8];34:231-6. Available from: http://www.mmj.eg.net/text.asp?2021/34/1/231/312036




  Introduction Top


GDM Gestational diabetes mellitus DM diabetes mellitus the baby during pregnancy and in the long term. During pregnancy, women with GDM are at increased risk of hypertension, pre-eclampsia, early delivery, induction of labor, and cesarean section [1]. The infants of diabetic mothers (IDM) with identified malformations were divided into two groups: those with isolated malformation and those with multiple malformations, described by more than one malformation [2]. The malformation used was defined as a structural abnormality of medical, surgical, or cosmetic importance diagnosed by either clinical examinations or imaging (ultrasound, computed tomography, MRI, or radiography) [3]. Considering the critical role of cytosolic enzymes in detoxifying the reactive oxygen species, glutathione S-transferase (GSTT1) (GST-theta) and GSTM1 (GST-mu) are two classes of multifactorial GST enzymes that are involved in the detoxification of a wide variety of carcinogenic and toxic compounds. GSTs take an important part in the defense mechanisms against the free radicals that are formed during oxidative stress in diabetes, especially in ocular tissue [4]. The aim of this work was to evaluate GST genetic variants in pregnant mothers with GDM and the degree of glycemic control and possible effect on their infants.


  Patients and methods Top


After approval of the Local Institutional Ethical Committee of Menoufia University Hospital and after taking a written consent from the participants. This case–control study was performed by selecting 80 pregnant women, divided into two groups: (a) patients group, which included 40 patients who had GDM according to WHO criteria, as defined by fasting plasma glucose test more than or equal to 92 mg/dl and/or 2 h plasma glucose test more than or equal to 150 mg/dl during the third trimester of pregnancy, and (b) control group, which included 40 apparently healthy pregnant women and their infants. They were recruited from the Obstetrics and Pediatric general clinic at Menoufia University hospitals during the period from October 2015 to April 2017. The inclusion criteria were all pregnant mothers with GDM and their infants. Exclusion criteria were mothers with chronic diseases (chronic renal failure, cardiac diseases, and type 1 and type 2 DM). All participants were subjected to detailed history taking, and anthropometric measurements were performed for both mothers and their infants with respect to weight, length, and head circumference. Laboratory investigations for all pregnant mothers were complete blood count, aspartate aminotransferase, alanine aminotransferase, urea, creatinine, fasting plasma glucose level, oral glucose tolerance test, 2-h postprandial plasma glucose level, and glycosylated hemoglobin (HbA1C), which was done for the assessment of glycemic control. Laboratory investigations for IDMs were complete blood count, serum calcium, serum magnesium, as well as random blood sugar (RBS), which was checked after labor at 1, 2, 3, 6, 12, 24, 36, and 48 h by glucometer check test. Molecular genetic study of GSH gene polymorphisms was done by taking samples: 2-ml of whole venous blood was collected into an EDTA tube, followed by DNA extraction by DNA extraction kit (GeneJET column based genomic DNA purification kit; Fermentas, Thermo, Fischer, 81 Wyman Street, Waltham, MA 02451 Scientific Inc., USA). Genomic DNA was amplified using PCR with different primer (forward and reverse). Sequences of primers used were as follows: for GSTM1: forward: 5′GAACTCCCTGAAAAGCTAAAGC3′ and reverse: 5′GTTGGGCTCAAATATACGGTGG3′, and for GSTT: forward: 5′TTCCTTACTGGTCCTCACATCTC3′ and reverse: 5′TCACGGGATCATGGCCAGCA-3′. Thermal cycling conditions were carried out in the thermo cycler PTC-100: the initial denaturation was done by one cycle at 94°C for 5 min, then denaturation by 35 cycles at 94°C for one minute followed by annealing by 35 cycles at 57°C for 1 min, and then elongation by 35 cycles at 72°C for 1 min. Finally, final elongation at 72°C for 10 min was performed. The PCR products were loaded onto a 2% agarose gel. GSTM1 and GSTT1 present genotypes yielded bands of 215 and 480 bp, respectively, the GSTTI-0 and GSTM1-0 were classified as null genotype for both GSTT1 and GSTM1 deletion variant. An internal control was applied with every reaction in a PCR multiplex manner to evaluate the successfulness of PCR composed of forward and reverse primers on exon-7 of the CYP1A1 gene (forward: 5′-GAACTGCCACTTCAGCTGTCT-3′ and reverse: 5′-CAGCTGCATTT GGAAGTGCTC-3′). CYP1A1 PCR product band corresponded to 312 bp.

Statistical analysis

Data were collected and entered to the computer using statistical package for social science, 18 (SPSS Inc., Chicago, Illinois, USA), program, for statistical analysis. Data were entered as numerical or categorical, as appropriate. Two types of statistics were done: (a) descriptive statistics, in which quantitative data were expressed in mean, SD of the mean, and SE and (b) qualitative data, which were expressed in number (frequency) and percent. Analytical statistics were done by using χ2 test and Fisher exact test to measure association between qualitative variables as appropriate. Moreover, Student t test, which is a test of significance, was used for comparison between two groups having quantitative variables. Mann–Whitney test (nonparametric test), which is a test of significance, was used for comparison between two groups not normally distributed having quantitative variables. The level of significance used was 95%, so P value more than 0.05 was considered statistically nonsignificant, P value less than 0.05 was considered statistically significant, and P value less than 0.001 was considered statistically highly significant. To define the optimal cutoff level of MPV measured in the acute hepatitis A, receiver operating characteristic curve analysis was used. The results of comparing the correlation between two continuous variables were indicated by the correlation coefficient (r) using correlation analysis.


  Results Top


A total of 80 pregnant women and their infants were enrolled in this study and divided into two groups: (a) patients group, which included 40 patients who had GDM, and (b) control group, which included 40 apparently healthy pregnant women. The mean age of diabetic mothers (DM) was 30.23 ± 5.428 years. We observed that there was no statistically significantly difference between mothers' weight (P = 0.07). Positive family history of DM was significantly higher among gestational diabetic mothers (GDM) group (55.0%) (P = 0.001). Median values of both systolic and diastolic blood pressure were significantly higher in GDM (128.75 ± 21.36/ 118 ± 21.15 mmHg) (P = 0.0001). Median values of 2-h postprandial blood sugar (PPBS) was significantly higher among GDM (201.8 ± 80.4 mg/dl). HbA1C was 6.845 ± 1.34% among GDM. Investigations among GDM like urea, creatinine, alanine aminotransferase, and aspartate aminotransferase were statistically insignificant (P > 0.05). IDM were born 80% at gestational age, 15% small for gestational age, and 5% large for gestational age, with significantly difference among their weight (P = 0.012). There were significant differences regarding. APGAR score at 1 min (P = 0.0001). Respiratory rate was significantly higher in IDM groups at 50 ± 12.4 breaths/min (P = 0.0001). Laboratory data of IDM showed that the hemoglobin and hematocrit level at the first hour of age were statistically insignificant (P = 0.36). RBS at the first hour of age was statistically significantly lower among IDM (P = 0.0001). There was no significant difference regarding serum calcium level in IDM (4.61 ± 1.2 mg/dl; P = 0.165) [Table 1]. In GDM, GSTM1-1 present genotype was present among 32.5% and GSTM1-0 null genotype was present among 67.5%, whereas it was 50% in present and null genotype in the control groups, which was statistically insignificant (P = 0.112). GSTT1-1 present genotype was 10% and GSTT1-0 null genotype was 90% in the case group, whereas it was 27.5% for present and 72.5% for null genotype in the control group, which was found to be statistically significant (P = 0.04). Among IDM, there was a statistically significant difference at GSTM1 gene polymorphism. The frequency of GSTM1-1 present genotype was 37.5% and GSTM1-0 null genotype was 62.5%, whereas it was 60% for present and 40% for null genotype in control groups (P = 0.04). There was no significant difference among GSTT1 gene polymorphism. The frequency of GSTT1-1 present genotype was 12.5% and GSTT1-0 null genotype was 87.5%, whereas it was 10% for present genotype and 90% for null genotype in the control groups (P = 0.723) [Table 2]. HbA1C was significantly higher in GSTT1-0 null genotypes (6.9 ± 1.1%) versus 5.63 ± 1.9% in GSTT1-1 present genotypes, with P value of 0.04. The relation of GSTM1-0 null genotype and the APGAR score of IDM at 1 min was significantly decreased in GSTM1-0 null genotype (7 ± 1.15%) versus in GSTM1-1 present genotype (7.7 ± 1.1%) (P = 0.043). The respiratory rate was significantly higher in GSTM1-0 null genotype (55.44 ± 11.65 breath/min) than in GSTM1-1 present genotype (42.6 ± 9.35 breath/min) (P = 0.002) [Table 3]. There was a significant negative correlation between HbA1C and fasting blood sugar (FBS) of GDM and low 1-min APGAR score of their infants. There was a significant positive correlation between PPBS and FBS of GDM and increased respiratory rates above normal limits of age of their infants. Among genotyping, a significant negative correlation was noted between GSTT1-0 null genotype of GDM and the respiratory rate of their infants. There was a significant positive correlation between GSTM1-0 null genotype of IDM and low 1-min APGAR score [Table 4]. Gel electrophoresis of GSTM1 is shown in [Figure 1]. Gel electrophoresis of GSTT1 is shown in [Figure 2].
Table 1: Data of mothers and their infants

Click here to view
Table 2: Frequency of glutathione S-transferase T1 and glutathione S-transferase M1 in mothers and their infants

Click here to view
Table 3: Association between glutathione S-transferase T1 of mothers and glutathione S-transferase M1 of their infants with clinical data

Click here to view
Table 4: Spearman's correlation of data of infants of diabetic mothers

Click here to view
Figure 1: Gel electrophoresis of glutathione S-transferase M1 (GSTM1).

Click here to view
Figure 2: Gel electrophoresis of glutathione S-transferase T1 (GSTT1).

Click here to view



  Discussion Top


GDM is any degree of glucose intolerance with onset or first recognition during pregnancy. The definition applies whether insulin or only diet modification is used for treatment and whether the condition persists after pregnancy [5]. Our study showed that there was a significant difference between the mean age of gestational diabetic mothers (GDM) and controls (30.23 ± 5.428 years and 26.4 ± 5.551 years, respectively) with P value of 0.002. This is in agreement with Orfan et al. [6], who showed a significantly difference between the mean ages of GDM (32.2 ± 5.1 years) and controls (28.6 ± 5.7 years) (P < 0.01). Regarding the weight of mothers with GDM, their weight ranged between 74 and 104 kg, and most of them were considered overweight. This was in agreement with Marginean et al. [7], who studied the BMI of pregnant mothers and found that 70.37% of his studied cases were included in the normal weight group, whereas 10.37% were underweight, 15.06% were overweight, and 4.2% were obese; however, for the gestational weight gain, 42.96% of the mothers presented with excessive weight gain during pregnancy. Our study showed that the positive family history of diabetes mellitus (DM) was statistically significant higher at GDM group (P = 0.001). This agreed with Orfan et al. [6], who showed that the family history of DM was significantly higher in GDM (P = 0.01). In the current study, systolic and diastolic blood pressures were significantly higher among the GDM group, as 52.2% (21) of our cases complained of gestational hypertension during pregnancy and were on antihypertensive drugs. In contrast, Orfan et al. [6] showed that the mean arterial blood pressure was within normal range in case and control groups (96.6 ± 10.9 and 96.6 ± 10.8 mmHg, respectively) (P = 0.99), with no significant difference. HbA1C in our study was significantly increased in GDM in relation to the control group (t = 6.042, P = 0.0001). This was in the same line with Xin et al. [8], who found that 48% of their studied group developed GDM compared with 11% with normal HbA1C. In our study, IDM birth weight had a significantly difference when compared with controls (P = 0.01). This is in concordance with Sridhar et al. [9], who showed that IDM birth weight had a significantly difference when compared with controls, but in disagreement with Cordero et al. [10], who showed that the birth weight of their studied groups was large for gestational age (4306 ± 30142 g) (P < 0.01). Hemoglobin and hematocrit level at first hour of age of IDM had no significantly when compared with controls. In contrast, Mitanchez et al. [11] showed higher level of hemoglobin and hematocrit at the first hour of age owing to polycythemia. RBS in IDM was statistically significantly lower at first hour of age (P = 0.0001) in comparison with controls, which was in agreement with Nally et al. [12], who showed that by continuous glucose monitoring, the mean RBS was 64 ± 20 mg/dl (P < 0.001). Rafiq et al. [13] showed lower calcium level in cases compared with controls (P = 0.02). This is in contrast to our study, where calcium level in IDM had no significantly difference with controls. In our study, GSTT1-0 null genotype was more frequent among GDM, with statistically significant difference between GDM group and control group, but there was an insignificant difference between GDM group and controls regarding GSTM1-0 null genotype. This is in contrast with Qui et al. [14], who showed no significant difference in the frequency of GSTT1-0 null genotype between case groups and control groups (P = 0.32) and significant difference in the frequency of GSTM1-0 null genotype polymorphisms (P = 0.0009). In our study, HbA1C was significantly higher in GSTT1-0 null genotypes than GSTT1-1, and there was no relation between GSTT1-0 null genotype and higher values of FBS for GDM. This is in accordance with Li et al. [15], who reported that HbA1C was significantly higher in GSTT1-0 null genotypes than GSTT1-1 (P = 0.02). In our study, GSTM1-0 null genotype was increased among IDM, and there was no significant difference regarding GSTT1 genotype. This is in concordance with Marginean et al. [7], who studied molecular patterns of IDM with respect only to their weight, as GSTM1-0 null genotype polymorphism had a significant positive effect on birth weight (P = 0.043), and no significant difference was noted in the frequency of GSTT1-0 null genotype polymorphism. APGAR score at 1 min was significantly decreased in GSTM1-0 null genotype than in GSTM1-1. IDM respiratory rate was significantly increased in GSTM1-0 null genotype than in GSTM1-1 genotype. This is in concordance with Spaight et al. [16], who showed that APGAR score at 1 min was significantly decreased in GSTM1-0 null genotype than in GSTM1. In our study, FBS and 2-h postprandial sugar of GDM were highly significant, which is in agreement with Berry et al. [17], who supported the use of FBS and 2-h PPBS as diagnostic tests of GDM.


  Conclusion Top


The results obtained in our study support the positive association between GSTT1-0 null genotype and the risk of the development of GDM. GSTM1-0 null genotype in IDM was positively correlated with the unfavorable presentation among affected newborns who are carriers of this polymorphism. Further studies are required to establish this finding.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Alison N, Sarah P, Jennifer C. Gestational diabetes mellitus: a pragmatic approach to diagnosis and management. Aust J Gen Pract 2018; 47:1–7.  Back to cited text no. 1
    
2.
Zang Y, Zhou ZG, Yang L, Lin J. Abnormal T cell autoimmunity against GAD65 in LADA patients. Zhonghua Yi Xue Za Zhi 2010; 90:1963–1965.  Back to cited text no. 2
    
3.
Nasri H, Houde K, Westgate MN, Hunt AT, Holmes LB. Malformations among infants of mothers with insulin-dependent diabetes: is there a recognizable pattern of abnormalities?. Birth Defects Res 2018; 110:108–113.  Back to cited text no. 3
    
4.
Moasser E, Azarpira N, Shirazi B, Geramizadeh B. Genetic polymorphisms of glutathione-D-transferase M1 and T1 genes at risk of diabetic retinopathy in Iranian population. Iran J Basic Med Sci 2014; 17:341–356.  Back to cited text no. 4
    
5.
Alwan N, Tuffnell DJ, West J. Treatments for gestational diabetes. Cochrane Database Syst Rev 2009; 8:CD003395.  Back to cited text no. 5
    
6.
Orfan O, Atalay MA, Orfan F, Karkucak M, Demir BC, Yakut T, et. al. Glutathione S-transferase M1 and T1 gene polymorphisms are not associated with increased risk of gestational diabetes mellitus development. West Indian Med J 2014; 63:300.  Back to cited text no. 6
    
7.
Marginean C, Banescu CV, Marginean CO, Tripon F, Melit LE, Iancu M. Glutathione S-transferase (GSTM1, GSTT1) gene polymorphisms, maternal gestational weight cross-sectional study in Romanian mothers and their newborns. Rom J Morphol Embryol 2017; 58:1–9.  Back to cited text no. 7
    
8.
Xin SC, Pravin RR, Rajadurai VS, Chandran S. Elevated glycated hemoglobin during pregnancy in diabetic women as a predictor of large-for-gestational age infants in an Asian cohort. J Clin Neonatol 2018; 7:136–140.  Back to cited text no. 8
    
9.
Sridhar S, Xu F, Hedderson MM. Trimester-specific gestational weight gain and infant size for gestational age. PLOS ONE 2016; 11:e0159500.  Back to cited text no. 9
    
10.
Cordero L, Paetow P, Nankervis CA. Neonatal outcomes of macrosomic infants of diabetic and non-diabetic mothers. J Neonat Perinat Med 2015; 8:105–112.  Back to cited text no. 10
    
11.
Mitanchez D, Yzydorczyk C, Siddeek B, Boubred F, Benahmed M, Simeoni U. The offspring of the diabetic mother Short- and long-term implications. Best Pract Res Clin Obstet Gynecol 2014; 29:1–14.  Back to cited text no. 11
    
12.
Nally LM, Bondy NW, Doiev J, Buckingham B, Willson D. A feasibility study to detect neonatal hypoglycemia using real-time continuous glucose monitoring. Diabetes Technol Ther 2018; 21:18–22.  Back to cited text no. 12
    
13.
Rafiq W, Hussain SQ, Jan M, Najar BA. Clinical and metabolic profile of neonates of diabetic mothers. Int J Contempt Pediatric 2015; 2:114–118.  Back to cited text no. 13
    
14.
Qui YH, Xu YL, Zhang WH. Effect of GSTM1, GSTT1, and GSTP1 IIe105Val polymorphisms on susceptibility to gestational diabetes mellitus. Genet Mol Res 2015; 15:1–7.  Back to cited text no. 14
    
15.
Li Y, Li S, Zhai Q, Hai J, Wang D, Cao M, et al. Association of GSTs polymorphisms with risk of gestational diabetes mellitus. Int J Clin Exp Pathol 2015; 8:15191–15197.  Back to cited text no. 15
    
16.
Spaight C, Gross J, Horsch A, Puder JJ. Gestational diabetes mellitus. Endo Cr Dev 2016; 31:163–178.  Back to cited text no. 16
    
17.
Berry DC, Johnson QB, Stuebe AM. Monitoring and managing mothers with gestational diabetes mellitus: a nursing perspective. Nurs Res Rev 2015; 5:91–97.  Back to cited text no. 17
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed44    
    Printed0    
    Emailed0    
    PDF Downloaded11    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]