Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2019  |  Volume : 32  |  Issue : 1  |  Page : 275-281

Cytochrome p450-2J2 gene polymorphism in patients with coronary artery disease


1 Department of Clinical Pathology, Faculty of Medicine, Menoufia University, Shebein El Kom, Menoufia Governorate, Egypt
2 Department of Biochemistry, National Liver Institute, Menoufia University, Shebein El Kom, Menoufia Governorate, Egypt
3 Department of Cardiology, Faculty of Medicine, Menoufia University, Shebein El Kom, Menoufia Governorate, Egypt

Date of Submission21-Aug-2017
Date of Acceptance08-Oct-2017
Date of Web Publication17-Apr-2019

Correspondence Address:
Aliaa A El Feshawy
Department of Clinical Pathology, Faculty of Medicine, Menoufia University, Shebein El Kom, Menoufia Governorate
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/mmj.mmj_584_17

Rights and Permissions
  Abstract 


Objective
The objective of this study was to study the CYP2J2 gene polymorphism in patients with coronary artery disease (CAD).
Background
Cytochrome P450 (CYP) 2J2 is expressed in the vascular endothelium and metabolizes arachidonic acid to epoxyeicosatrienoic acids. Epoxyeicosatrienoic acids are vasodilators and inhibitors of vascular inflammation.
Patients and methods
This case–control study was carried on 80 participants; 55 of them had CAD and 25 control participants had no coronary artery stenosis. They were selected from Cardiac Catheterization Laboratory of Menoufia University Hospital from November 2015 to March 2017. They underwent a full history, clinical examination, ECG, random blood glucose level, lipid profile (triglycerides, total cholesterol, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol), and CYP2J2 polymorphism assessment by real-time PCR assay.
Results
The CYP2J2 genotype, alleles, and the dominant model (CC vs. CT + TT) distributions of single-nucleotide polymorphism (rs2280275) showed a significant difference between patient and control groups for total participants and males (for genotype: P < 0.001; for allele: P < 0.001; for dominant model: P < 0.001 respectively). The multiple logistic regression analysis for total participants and males showed that those who had either TT or CT were 1.08 and 1.09 times, respectively, to have CAD. The CYP2J2 genotype, alleles, and the dominant model distributions showed a significant difference between the two vessel groups (for genotype: P = 0.032; for allele: P = 0.007; for dominant model: P = 0.029).
Conclusion
The obtained results suggested that CYP2J2 polymorphism was associated with an increased risk of CAD.

Keywords: arachidonic acid, coronary artery disease, CYP2J2, ECG, single-nucleotide polymorphism


How to cite this article:
Noreldin RI, Azzam AA, Yaseen RI, El Feshawy AA. Cytochrome p450-2J2 gene polymorphism in patients with coronary artery disease. Menoufia Med J 2019;32:275-81

How to cite this URL:
Noreldin RI, Azzam AA, Yaseen RI, El Feshawy AA. Cytochrome p450-2J2 gene polymorphism in patients with coronary artery disease. Menoufia Med J [serial online] 2019 [cited 2019 May 27];32:275-81. Available from: http://www.mmj.eg.net/text.asp?2019/32/1/275/256128




  Introduction Top


Coronary artery disease (CAD) results from an interaction between genetic and environmental factors [1]. Genetic basis of CAD has gained importance in the development of CAD [2]. The metabolites of CYP have critical roles in the maintenance of cardiovascular health [3]. CYP2J2 is expressed in the vascular endothelium and metabolizes arachidonic acid to 5, 6-epoxyeicosatrienoic acid (EET), 8, 9-EET, 11, 12-EET, and 14, 15-EET [4]. These EETs dilate coronary arteries, reduce vascular inflammation, and increase intravascular fibrinolysis that could protect the cardiovascular system [5]. Polymorphisms within CYP2J2 can result in the variation of EETs, which increase development of cardiovascular disease [6].

The aim of this work was to study the association between CYP2J2 gene polymorphism and CAD.


  Patients and Methods Top


Patients

This case–control study was carried out on 80 participants who presented during the period of study and fulfilled all the required criteria; 55 of them were patients with CAD (45 males and 10 females) and 25 were control participants with normal results on the coronary angiogram (20 males and five females). All patients and controls had chest pain and underwent coronary angiogram, whereas participants with impaired renal function, malignancy, or valvular disease were excluded. They were selected from Cardiac Catheterization Laboratory of Menoufia University Hospital from November 2015 to March 2017. The approval of the ethical committee and written consents were taken from all participants. CAD cases were diagnosed by the presence of one or more coronary artery stenosis of more than 50% in luminal diameter on coronary angiography. The control group was exposed to same risk factors of CAD but the results of angiogram were normal.

Methods

All individuals were subjected to history taking, clinical examination, ECG, random blood glucose level, lipid profile [triglycerides, total cholesterol, low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C)] (AU680; Beckman Coulter, Brea, California, USA), and CYP2J2 polymorphism assessment, which was determined by real-time PCR assay.

Sampling

  1. One microliter was delivered to plain vacutainer tube, left 15 min for coagulation, and then centrifuged at 3000 rpm for 10 min. Thereafter, the serum was separated for measurement of random blood glucose level
  2. Five microliters of blood was taken after fasting up to 12–14 h and divided into the following: 3 ml was delivered to plain vacutainer tube, left 15 min for coagulation, and then centrifuged at 3000 rpm for 10 min. Then, the sera were separated for measurement of lipid profile. The remaining 2 ml was delivered to EDTA-containing tube for DNA extraction.



  Dna Extraction and Genotyping Top


Genomic DNA was isolated from EDTA-preserved whole blood using G-spin Total DNA Extraction Kit spin-column technique kit (iNtRON Biotechnology, Korea, 1500 District Avenue Suite 2097, Burlington, MA 01803 USA). After ethanol precipitation, the DNA was purified and dissolved in double distilled water and frozen at −20°C until use. rs2280275 single-nucleotide polymorphism in CYP2J2 gene was determined by real-time PCR using the ABI TaqMan allelic discrimination kit (catalogue # 4351379, assay ID C_1917967_20; Applied Biosystems) and the ABI 7500 Real Time PCR System (Applied Biosystems, Waltham, Massachusetts, USA). The sequence of VIC/FAM was as follows: TCTCTTTCCTCCAATGTCTAGTACA[C/T] GGCACCCCACTCCCCATGGTAGGTT (VIC dye for allele C, FAM dye for allele T). PCR cycling conditions were 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min.

The software of the real-time PCR instrument (ABI 7500; Applied Biosystems) plots the results of the allelic discrimination run on a scatter plot of allele 1 versus allele 2. Each well of the reaction plate was represented as an individual point on the plot [Figure 1].
Figure 1: Allelic discrimination and amplification plots of Taqman genotyping assay for CYP2J2 at Applied Biosystems 7500. Allelic discrimination plot shows VIC dye fluorescence at x-axis and FAM dye fluorescence at y-axis. The amplification plot (ΔRn vs. cycle) shows ΔRn values, which is the magnitude of fluorescent signal generated during PCR at each time point at y-axis.

Click here to view


Statistical analysis

Results were statistically analyzed by SPSS, version 20 (SPSS Inc., Chicago, Illinois, USA). Student's t-test and analysis of variance (F-test) were used for parametric data. Mann–Whitney and Kruskal–Wallis tests were used for nonparametric data. χ2 and Fisher's exact tests were used for qualitative variables. Odds ratio (OR) was used to estimate the risk. Logistic regression was used to assess the likelihood of occurrence of certain parameter. P value less than 0.05 was considered significant.


  Results Top


No significant differences were found between the six studied groups in age and sex [Table 1]. There was a statistically significant difference between patients and controls of both total participants and male participants regarding diabetes mellitus (DM), hypertension (HTN), smoking, glucose, total cholesterol, and LDL-C [Table 1]. There was a significant statistical difference between less than or equal to 2 and more than 2 atherosclerotic coronary vessels groups regarding HTN, glucose, triglycerides, total cholesterol, and LDL-C [Table 1].
Table 1: Criteria of studied groups

Click here to view


The frequency distributions of the different genotypes of CYP2J2 polymorphism in total participants and males showed that there was a higher percentage of CC genotype among control group than patients group (52 vs. 16.4% and 60 vs. 15.6%, respectively), higher percentage of CT genotype among patient group than control group (29.1 vs. 28%, P = 0.05 and 31.1 vs. 20%, P = 0.012, respectively), and significant higher percentage of TT genotype among patient group than control group (54.5 vs. 20%, P < 0.001 and 53.3 vs. 20%, P < 0.001, respectively) [Table 2] and [Figure 2]. There was a significantly higher percentage of T allele among patient group than control group (69.1 vs. 34%, P < 0.001 and 68.9 vs. 30%, P < 0.001, respectively) [Table 2]. The dominant model in total and male participants (CC vs. CT + TT) showed a significant difference between patients and controls (P < 0.001 and < 0.001, respectively) [Table 2].
Table 2: Genotype of studied groups

Click here to view
Figure 2: CYP2J2 genotype and allele frequencies of total participants.

Click here to view


To evaluate the risk of CAD in total participants and males according to the CYP2J2 genotype using the CC genotype as the reference genotype, CT genotype was associated with increased risk of CAD [for total participants, OR = 3.30, 95% confidence interval (CI)=0.97–11.29, P = 0.05, and for males, OR = 6.0, 95% CI = 1.41–25.59, P = 0.012], and also TT genotype was associated with increased risk of CAD (for total participants, OR = 8.67, 95% CI = 2.43–30.93, P < 0.001, and for males, OR = 10.29, 95% CI = 2.51–42.15, P < 0.001) [Table 2].

The frequency distributions of the different genotypes for CYP2J2 polymorphism in less than or equal to 2 and more than 2 atherosclerotic vessels groups showed a significantly higher percentage of TT genotype among more than 2 atherosclerotic vessels group than 2 atherosclerotic vessels group (72.7 vs. 37.5%, P = 0.032) [Table 2]. There was a significant higher percentage of T allele among more than 2 atherosclerotic vessels group than less than equal to 2 atherosclerotic vessels group (81.8 vs. 43.7%, P = 0.007) [Table 2]. Dominant model (CC vs. CT + TT) showed a significant difference between more than 2 atherosclerotic vessels group and less than or equal to 2 atherosclerotic vessels group (P = 0.029) [Table 2]. TT genotype was associated with increased risk of CAD (OR = 10.67, 95% CI = 1.31–86.94, P = 0.032) [Table 2]. The present study found that CT and TT genotypes were associated with high level of triglycerides, total cholesterol, and LDL-C levels [Table 3].
Table 3: Comparison among CYP2J2 genotype in patients and vessels group regarding laboratory variables

Click here to view


Multiple logistic analyses were done to ascertain the effects of genotype, glucose, LDL-C, HTN, DM, and smoking on the likelihood that participants have CAD. For total participants, smokers were 13.80 times more likely to exhibit CAD. Those who have either TT or CT were 1.08 times more likely to exhibit CAD. Increasing LDL-C was associated with an increased probability of exhibiting CAD. However for males, it was found that smokers were 14.40 times more likely to exhibit CAD. Those who have either TT or CT were 1.09 times more likely to exhibit CAD [Table 4].
Table 4: Multiple logistic regression analysis for patients with coronary artery disease and control participants

Click here to view



  Discussion Top


CAD is a major cause of morbidity and mortality all over the world [7]. Many studies found associations between single-nucleotide polymorphisms and CAD. CYP2J2 is a protein that in human is encoded by the CYP2J2 gene and catalyzes the epoxidation of arachidonic acid to 5, 6-EET, 8, 9-EET, 11, 12-EET, and 14, 15-EET. EETs could fight against cardiovascular diseases because they dilate the coronary arteries, reduce the vascular inflammation, and increase the intravascular fibrinolysis [8].

In the present study, the gained results showed that DM and glucose level were significantly higher in patients with CAD compared with control group. This is agreed by Tousoulis et al. [9] and Nielson et al. [10] whostated that patients with diabetes have a high incidence of CAD, as diabetes is involved in atherosclerotic plaque formation.

The obtained results showed that HTN was significantly higher in CAD than control group. This is consistent withOparil et al. [11] who found that elevated blood pressure can cause endothelial injury that enhances the vascular occlusion.

Considering the effect of smoking on CAD, the gained results showed that smoking was a major risk factor for CAD. John and Rajat [12] found that cigarette smoking influences all phases of atherosclerosis. This study showed a significant difference between patients with CAD and control group regarding total cholesterol level and LDL-C level. This is consistent with Daida et al. [13] who found a linear relationship between the incidence of CAD and LDL-C.

Regarding the genotyping results in the present study, it was found that the CC genotype was higher in control group compared with CAD group (52 vs. 16.4%). However, CT and TT genotypes were higher in patients with CAD (29.1 vs. 28% and 54.5 vs. 20%) in comparison with control group. The C allele was more represented in control group (66%) than in CAD group (30.9%), whereas T allele showed a higher frequency in patients with CAD (69.1%) compared with control group (34%). The gained results were in agreement with Zhu et al. [14] who found that the CC genotype of rs2280275 in CYP2J2 was higher in control group compared with CAD (75 vs. 66.96%). However, CT and TT genotypes were higher in patients with CAD (4.76 vs. 3.57% and 28.27 vs. 21.43%) in comparison with control group. Moreover, C allele was more represented in control group (85.71%) than in CAD group (81.1%), whereas T allele showed a higher frequency in CAD group (18.9%) compared with control group (14.29%).

This was explained by Spiecker et al. [15] who found that human CYP2J2 gene is highly polymorphic, influencing activity of the enzyme and affecting the metabolism of arachidonic acid, resulting in an altered synthesis of EETs. Wu et al. [16] reported that polymorphisms within CYP2J2 can result in the variation of EETs, which may increase risk of cardiovascular disease. Rs2280275 of CYP2J2 cannot cause direct changes of amino acids because it is an intron polymorphism but can change the dimensional structure of DNA, influence splicing and transcription owing to its location close to the splice site of exon2 of CYP2J2.

Regarding the genotyping results in males in this study, it was found that the CC genotype was higher in control group compared with CAD (60 vs. 15.6%). However, CT and TT genotypes were higher in patients with CAD (31.1 vs. 20% and 53.3 vs. 20%) in comparison with control group. The C allele is more represented in control group (70%) than in patients with CAD (31.1%), whereas T allele shows a higher frequency in patients with CAD (68.9%) compared with control group (30.0%). The obtained results were agreed with Chaudhary et al. [17] who found that distribution of rs2280275 genotypes showed a significant difference between CAD and control participants in males owing to sex hormones. Sex hormones such as estrogens protect against oxidative stress and are vaso-protective. In addition, some studies informed that estrogens protect the EETs against being hydrolyzed by soluble epoxide hydrolase.

The results of the present study showed that the number of coronary arteries that were affected with atherosclerosis was increased in patients with HTN, high blood glucose level, and hyperlipidemia. This was in agreement with Mahalle et al. [18] who found that individuals with metabolic syndrome had a higher prevalence of multivessel disease than those without the metabolic syndrome.

The results of this study showed that there was a significant increase in the number of atherosclerotic coronary arteriesin patients with CYP2J2 polymorphism. The gained results showed that the T allele showed a higher frequency in patients with more than 2 atherosclerotic vessels group (81.8%) compared with patients with less than or equal to 2 atherosclerotic vessels group (43.7%). This was explained by Chaudhary et al. [19] who found that EETs play a role in regulating cardiac hormones such as natriuretic peptides, following ischemia-reperfusion injury. Moreover, EETs act as potent vasodilators in the coronary microcirculation and relax vascular smooth muscle cells. The results of this study were consistent with Imig et al. [20] who found that polymorphism in the CYP2J2 gene reduces CYP2J2 transcription, reduces plasma EET levels, and has been demonstrated to be associated with increased risk for essential HTN and atherosclerosis.

The results of the present study showed that the logistic regression model was statistically significant for total and male participants, which was consistent with Zhu et al. [21], who found that the significant difference of rs2280275 was intact after adjustment for glucose, LDL-C, HTN, DM, and smoking.


  Conclusion Top


The present study showed that rs2280275 polymorphism in CYP2J2 gene is associated with CAD. TT genotype and T allele of rs2280275 of CYP2J2 increase the risk of development of CAD. rs2280275 polymorphism in CYP2J2 gene in patients with CAD is recommended to be studied on larger sample size to confirm its diagnostic value.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Sanchis-Gomar F, Perez-Quillis C, Leischik R, Lucia A. Epidemiology of coronary heart disease and acute coronary syndrome. Ann Transl Med 2016; 4:256.  Back to cited text no. 1
    
2.
Dai CF, Xie X, Yang YN, Li XN, Zheng YY, Fu ZY, et al. Relationship between CYP17A1 genetic polymorphism and coronary artery disease in a Chineese Han population. Lipids Health Dis 2015; 14:16.  Back to cited text no. 2
    
3.
Zordoky BN, El-Kadi AO. Effect of cytochrome P450 polymorphism on arachidonic acid metabolism and their impact on cardiovascular diseases. Pharmacol Ther 2010; 125:446–463.  Back to cited text no. 3
    
4.
Moshal KS, Zeldin DC, Sithu SD, Sen U, Tyagi N. Cytochrome P450 gene transfection attenuates MMP-9 via inhibition of NF-kappa beta in hyperhomocysteinemia. J Cell Physiol 2008; 215:771–781.  Back to cited text no. 4
    
5.
Sudhahar V, Shaw S, Imig JD. Epoxyeicosatrienoic analogs and vascular function, Curr Med Chem 2010; 17:1181–1190.  Back to cited text no. 5
    
6.
Lee CR, North KE, Bray MS, Couper DJ, Heiss G. CYP2J2 and CYP2C8 polymorphisms and coronary heart disease risk: the Atherosclerosis Risk in Communities (ARIC) study. Pharmacogenet Genomics 2007; 17:349–358.  Back to cited text no. 6
    
7.
Berlin DS, Sangkuhl K, Klein TE. Cytochrome P450, family 2, subfamily J, polypeptide 2: CYP2J2. Pharmacogenet Genomics 2011; 21:308–311.  Back to cited text no. 7
    
8.
Kumar R, Kapur S. Cytochrome P450 biocatalysts: a route to bioremediation. Inter J Pharm Res Allied Sci 2016; 5:113–123.  Back to cited text no. 8
    
9.
Tousoulis D, Kampoli AM, Papageorgiou N, Papaoikonomou S, Antoniades C, Stefanadis C. The impact of diabetes mellitus on coronary artery disease: new therapeutic approaches. Curr Pharm Des 2010; 15:2037–2048.  Back to cited text no. 9
    
10.
Nielson C, Lange T, Hadjokas N. Blood glucose and coronary artery disease in nondiabetic patients. Diabetes Care 2006; 29:998–1001.  Back to cited text no. 10
    
11.
Oparil S, Zaman M, Calhoun D. Pathogenesis of hypertension. Ann Inter Med 2003; 139:761–776.  Back to cited text no. 11
    
12.
John A, Rajat S. The pathophysiology of cigarette smoking and cardiovascular disease. J Am Coll Cardiol 2004; 43:1731–1737.  Back to cited text no. 12
    
13.
Daida H, Teramoto T, Kitagawa Y, Matsushita Y, Sugihara M. The relationship between low-density lipoprotein cholesterol levels and the incidence of cardiovascular disease in high-risk patients treated with pravastatin: main results of the approach-J study. Int Heart J 2014; 55:39–47.  Back to cited text no. 13
    
14.
Zhu Q, Amjad A, Fu Z, Ma Y, Huang D, Xie X, et al. Single nucleotide polymorphism of the CYP2J2 gene is associated with essential hypertension in Uygur population in China. Biochem Anal Biochem 2015; 4:159–164.  Back to cited text no. 14
    
15.
Spiecker M, Darius H, Hankeln T, Soufi M, Sattler AM, Schaefer JR, et al. Risk of coronary artery disease associated with polymorphism of the cytochrome P450 epoxygenase CYP2J2. Circulation 2004; 110:2132–2136.  Back to cited text no. 15
    
16.
Wu SN, Zhang Y, Gardner CO, Chen Q, Li Y. Evidence forassociation of polymorphisms in CYP2J2 and susceptibility to essential hypertension. Ann Hum Genet 2007; 71:519–525.  Back to cited text no. 16
    
17.
Chaudhary KR, Zordoky BN, Edin ML, Alsaleh N, El-Kadi AO. Differential effects of soluble epoxide hydrolase inhibition and CYP2J2 overexpression on postischemic cardiac function in aged mice. Prostaglandins Other Lipid Mediat 2012; 123:1–10.  Back to cited text no. 17
    
18.
Mahalle N, Garg MK, Naik SS, Kulkarni MV. Study of pattern of dyslipidemia and its correlation with cardiovascular risk factors in patients with proven coronary artery disease. Indian J Endocr Metab 2014; 18:48–55.  Back to cited text no. 18
    
19.
Chaudhary KR, Batchu SN, Das D, Suresh M, Falck JR, Graves JP, et al. Role of B-type natriuretic peptide in epoxyeiocosatrienoic acid mediated improved postischemic recovery of heart contractile function. Cardiovasc Res 2009; 83:362–370.  Back to cited text no. 19
    
20.
Imig JD. Epoxides and soluble epoxide hydrolase in cardiovascular physiology. Physiol Rev 2015; 92:101–130.  Back to cited text no. 20
    
21.
Zhu Q, Fu Z, Ma Y, Yang H, Huang D, Xie X, et al. A novel polymorphism of the CYP2J2 gene is associated with coronary artery disease in Uygur population in China. Clin Biochem 2013; 46:1047–1054.  Back to cited text no. 21
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and Methods
Dna Extraction a...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed78    
    Printed2    
    Emailed0    
    PDF Downloaded7    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]